Research Article (Open access)

SSR Inst. Int. J. Life Sci., 5(6): 2442-2448, November 2019

 

Expression of Pediocin PA-1 in Escherichia coli

 

Nguyen Thi Cam Nhung1, Nguyen Hieu Nghia1, Dang Thi Phuong Thao1,2,*

 

1Department of Molecular and Environmental Biotechnology, Faculty of Biology and Biotechnology, University of Science, Vietnam National University-Ho Chi Minh City, Ho Chi Minh City 70000, Vietnam

2Laboratory of Molecular Biotechnology, University of Science, Vietnam National University-Ho Chi Minh City, Ho Chi Minh City 70000, Vietnam

 

*Address for Correspondence: Dr. Dang Thi Phuong Thao, Head, Department of Molecular and Environmental Biotechnology, University of Science, Vietnam National University, Ho Chi Minh City, 227 Nguyen Van Cu Street, District 5, Ho Chi Minh City, Vietnam

E-mail: dtpthao@hcmus.edu.vn  

 

ABSTRACT- Background: Pediocinis an antimicrobial peptide, which strongly inhibits Listeria monocytogenes. Previous reports showed that pediocin remarkable and promising potential in the food preservation industry and pharmaceutical. Although pediocin had been expressed in some E. coli strains, the production of pediocin still need more study.

Methods: In this study, we present our results on expression recombinant pediocin as solble protein in E. coli. N-terminus of the pediocin gene was incorporated into the NusA tag, coordinated with 6xHistidine.

Results: Active recombinant pediocin was successfully obtained and showed its strong antibacterial activity against L. monocytogenes ATCC.

Conclusion: The result will be opened a new door to produce recombinant pediocin and apply it.

Key Words: Antibacterial activity, E. coli expression, Pediocin, Listeria monocytogene, NusA tag


INTRODUCTION- Pediocin PA-1 is a class IIa bacteriocin which produced by Pediococcus acidilactici PAC1.0. [1,2]. Pediocin PA-1 has a wide antibacterial spectrum against Gram-positive bacterial sp. such as Lactobacilli, Leuconostoc, Brochothrix thermosphacta, Probionibacteria, Bacilli, Enterococci, Staphylococci, L. clostridia, L. monocytogenes, and L. innocua. Pediocin was commercialized as a food presevative for several types of foods, particularly, which have to be prevented from L. monocytogenes [3]. As nisin, pediocin is widely applied in food presevation, particularly which is strictly prohibited from L. monocytogenes. Previous studies reported that pediocin showed its effectiveness of preservation, several different kinds of food such as sausage, milk, chicken meat, beef, salmon [4-11]. Pediocin could be used directly as metabolite from Pediococcus, when the microorganism was added into sausage and milk [4,5]. Besides, purified pediocin was added into foods [7-10]. In the order hand, pediocin was also reported as anticancer activity on liver cell line A-549 [12]. Recombinant pediocin had been produced from some different expression systems including E. coli. Halami, 2007, reported that recombinant pedicoin was successfully produced in inclusion bodies of E. coli BL21 (DE3). The recombinant pediocin was then refolded and purified to obtain its antibacterial activity on the L. monocytogenes V7 [13]. Pediocin PA-1 was also expressed in E. coli M15 as fusion protein with His-tagged mouse dihydrofolate reductase (DHFR). The recombinant pediocin showed its antibacterial activity against L. plantarum NCDO 955 [14]. In this study, we show our results on producing recombinant pediocin as soluble protein in E. coli BL21(DE3).

MATERIALS AND METHODS- The study was performed in the Laboratory of Molecular and Environmental Biotechnology, University of Science, VNU.HCM, Vietnam from 2016 to 2019.

 

Strains and Plasmid- DH5α E. coli (F-, φ80lacZΔM15, recA1, endA1, hsdR17 (rk-, mk+), phoA, supE44, λ-, thi-1, gyrA96, relA1), BL21(DE3) E. coli F-, ompT, hsdSB (rB-, mB-), gal, dcm (DE3) and plasmid pET43.1a(+) were purchased from Invitrogen. Indicator bacteria were suported by Laboratory of Molecular and Environmental Biotechnology, University of Science, VNU.HCM, Vietnam.

E. coli strain was grown at 37oC in low salt Luria-Bertani (LB) broth (1% tryptone, 0.5% yeast extract, 0.5% NaCl). Plamsid carried E. Coli was grown on LB medium, which supplemented with ampicillin (100 μg/ml). Indicator strains were grown at 37oC in Tryptic Soy Broth (Tryptone 1.7%, Peptone 0.3%, D-glucose 0.25%, NaCl 0.5%, K2HPO4 0.25%).

 

Construction of recombinant vector pET43.1a-ped- The construction of recombinant vector was designed following et al. [15] with modification. Pediocin encoding gene was synthesized based on nucleotide sequence of pediocin gene in P. acidilactici PAC1.0. and amplified by PCR with set of primers (BamHI-ped: CGCGGATCCGATGACGACGACAAGAAATATTATGGTAATGGTGTTACCTGTGGTAAACATAGC and XhoI-ped: CCGCTCGAGCGGTTAACATTTATGATTACCCTGATGA CCACC). The Bam HI-XhoI-pediocin DNA fragment was then inserted into pET43.1a(+) vector by T4 ligase. The T4 ligation product was transformed into DH5α E. coli. The recombinant vector was analyzed by PCR and sequencing.

Expression of NusA-his-pediocin fusion protein- The expression of recombinant pediocin was performed followed by Moon et al. [15] with modification. Recombinant plasmid pET43.1a-ped was transformed into BL21 (DE3) E. coli. TheBL21(DE3) E. coli transformed strain were induced by IPTG 0.8 mM when the optical density reaches 0.6-0.8 units (OD600= 0.6–0.8) then harvested by centrifugation at 5000 rpm for 7 minutes after 2 hours further grown. The cell pellet after harvested was re-suspended in the binding buffer containing Na2HPO4 50mM, NaCl 300 mM, Imidazole 10mM pH 7.4 then sonicated using a homogenizer to disrupt the cells. To separate the precipitate and soluble fractions, the cell lysates then obtained by centrifugation at 13000 rpm for 15 minutes. To determine the presence and location of fused-pediocin, 3 fractions: total, precipitate and soluble of was checked for the expression by SDS-PAGE and confirmed indirectly by Western blot with anti-his antibody (Invitrogen).

 

Pediocin purification by affinity chromatography- Thepurification of recombinant pediocin was followed by Moon et al. [15] with modification. Soluble fraction from E. coli lysate was filtered by 0.2 mm low-protein-binding membrane and 10 ml of sample was applied to nickel-NTA agarose resin, which was first equilibrated by 5 CV binding buffer, followed by 15 CV buffer A containing Na2HPO4 50 mM, NaCl 300 mM, pH 7.4 to wash the column. The NusA-his-pedioc infused pediocin was eluted by buffer B (50 mM NaH2PO4, 300 mM NaCl, 500 mM Imidazole pH 7.4). Eluted protein was analyzed by SDS-PAGE and Bradford assay.

 

Antimicrobial assay on Tricine SDS-PAGE gel- Antibacterial assay on tricine SDS-PAGE gene was applied as described by Bhunia et al. [16]. Two SDS-PAGE gels were run under the same condition, one was used for silver stained and the other was fixed with a solution containing 10% acetic acid and 20% isopropanol for 30 minutes, wash carefully with deionized water overnight. The gel was placed into a sterile petri dish and overlaid with 5 ml soft TSB-agar medium containing indicator bacteria, which was prepared the same as in the agar diffusion test. The test plate was incubated at 37oC until the inhibition zone was observed.

RESULT

Pediocin expression in E. coli- To express pediocin in the cytoplasm of the E. coli cells, we introduce pediocin encoding gene into pET43.1a vector (Fig. 1).

 

Fig. 1: Construction of peidocin expression vector in E. coli

A: Obtaining pediocin gene with BamHI/XhoI cohesive ends

B: Obatining pET43.1a with BamHI/XhoI cohesive ends

 C: Introduction of recombinant vector into DH5α E. coli

D-G: Confirmation of pediocin expression vector and recombinant vector carried BL21 Dec. PCR

 

After cloning E. coli Bl21 Dec3 strain was utilized to express pediocin. Since pET43.1a was designed to express the soluble heterologous protein in E. coli, the recombinant pediocin was obtained as a soluble protein in the cytoplasm (Fig. 2). Besides, N-terminus of the pediocin encoding gene (ped) was fused with 6x histidine, sequenced by NusA tag, thereby the NusA-his-Pediocin fusion protein was detected by Wetern Blot with anti-his antibody. After the expression process, recombinant protein was obtained and introduced into SDS-PAGE analysis. The results showed that pediodin was expressed as NusA-his-pediocin fused protein with the molecular mass of more than 66 k Da, confirmed by the Western blot with anti-his-antibody (Fig. 2).

 

Fig. 2: Expression of recombinant pediocin in E. coli. L: protein ladder; p43.1a: extracted protein from E. coli/ pET43.1a. ; p43.1a-ped: extracted protein from E. coli with carrying pediocin expressing vector / pET43.1a-ped.  : Total protein from the E. coli cells.

: Peletted protein from the E. coli cells. -: Soluble protein from the E. coli cells

Collection of active recombinant pediocin- In order to collect active pediocin, NusA-his-pediocin was obtained from E. coli and was purified by nickel-NTA column. The results in Fig. 3 showed that we have successfully obtained NusA-His-pediocin after elution by 20% buffer B (50 mM NaH2PO4, 300 mM NaCl, 500 mM Imidazole pH 7.4). The eluted protein was in 46.92ฑ3.12% purity and in 77.15ฑ11.79% collected yield. Although we could collect NusA-his-pediocin in the fraction which was eluted by 30% buffer B with 95.3% of purity, the recovery was quite low (18.445.53 %).

Table 1: Purify of NusA-his-pediocin protein

NusA-his-pediocin

Total protein in supernatant

Eluted protein

(20% B)

Eluted protein

(20% B)

Purity (%)

24.43ฑ3.57

46.92ฑ3.12

95.3%

Yield (mg)

2.793ฑ0.869

2.155ฑ0.549

0.515ฑ0.034

Recovery (%)

100

77.15ฑ11.79

18.445.53

 

The eluted NusA-his-Pediocin protein was then traeted by enterokinase enzyme in order to collect pediocin. The collected pediocin was applied to check its antibacterial activity by using L. monocytogene MT as indicator bacteria (Fig. 4). The results demonstrated that after treated by enterokinase we could release pediocin from the fusion NusA-his-pediocin protein and the free pediocin was about 4.6 kDa with the antibacterial activity of L. monocytogene MT.

Fig. 3: Purification of NusA-his-pediocin

L: Protein ladder; S: Supernatant fraction from E. coli cell extract; F: Follow through fraction; W: Wash fraction; E20: elution fraction with 20% buffer B; E30: elution fraction with 30% buffer B

Fig. 4: Antibacterial activity of recombinant pediocin

L: protein ladder; nonEK: NusA-his-pediocin without enterokinase treatment. EK: NusA-his-pediocin after enterokinase treatment

Analysis of the antimicrobial spectrum of recombinant pediocin- Beside L. monocytogenes, antimicrobial spectrum of recombinant pediocin was also analyzed. The results showed that recombinant pediocin has antibacterial activity against Gram positive bacteria such as L. monocytogene, L. inocua, Enterococcus faecalis. Besides, the recombinant peptide pediocin also inhibited Gram negative bacteria such as Shigella boydii, Vibrio parahaemolyticus (Table 2).

 

Table 2: Antimicrobial spectrum of recombinant pediocin

 

S. No.

Indicator

Gram

Antibacterial activity

1

Aeromonas caviae B168

–

–

2

Aeromonas dhakensis B77

–

–

3

Aeromonas hydrophila B56

–

–

4

Aeromonas hydrophila B66

–

–

5

Aeromonas veronii B141

–

–

6

Bacillus cereus

+

–

7

Bacillus subtilis DHCT

+

–

8

Clostridium botulinum E

+

–

9

Clostridium botulinum D

+

–

10

Clostridium perfringen 1

+

–

11

Enterococcus faecalis

+

+

12

Escherichia coli 1/6

–

–

13

Escherichia coli DHCT

–

–

15

Edwardsiella ictaluri LMG-Gly09M

–

–

16

Edwardsiella tarda ATCC 15947

–

–

17

Enterobacter cloacae DHCT

–

–

18

Enterotoxigenic Escherichia coli (ETEC)

–

–

19

Listeria inocua

+

+

20

Listeria monocytogen 364

+

+

21

Listeria monocytogene

+

+

22

Listeria monocytogene MT

+

+

23

Pseudomonas aeruginosa

–

–

24

Pseudomonas aeruginosa DHCT

–

–

25

Staphylococcus aureus 1

+

–

26

Staphylococcus aureus 2

+

–

27

Staphylococcus aureus B12

+

–

28

Staphylococcus aureus DHCT

+

–

29

Salmonella dublin

–

–

30

Salmonella enteritidis

–

–

31

Salmonella sonei

–

–

32

Salmonella typhi

–

–

33

Salmonella typhimurium

–

–

34

Shigella boydii

–

+

35

Shigella dysenteria

–

-

36

Shigella flexneri

–

-

37

Vibrioparahaemolyticus

–

+

38

Vibrio parahaemolyticus L2

–

-

 

DISCUSSION- Pediocin PA-1 is well known as an antimicrobial peptide with strong antibacterial activity against quite wide, broad of Gram positive pathogens such as L. monocytogenes, Staphylococcus aureus, Enterococcus faecalis. Pediocin thereby was reported as food preservatives to inhibit the growth of L. monocytogenes in some kind of meat and meat-related products such as Frankfurters, breast meat as well as fish product [17,18]. In this study, we successfully obtained recombinant pediocin from E. coli by using pET43a.1 vector. The recomniant pediocin was about 4.6kDa and showed its trong activity against not only on several gram positive bacteria as Enterococcus faecalis, L. innocua, L. monocytogen 364, L. monocytogene, L. monocytogene MT. Interestingly, the recombinant pediocin in this study also inhited two Gram negative bacteria Shigella boydii, Vibrio parahaemolyticus, which had not been reported before on bactibase database. The results suggested a deffirent mechanism of pediocin activity. The antibacterial activity of recombinant pediocin in this study is similar to pediocin from in Pediococcus pentosaceus K23-2 Shin et al. [19] and Papagianni et al. [20].

CONCLUSIONS- Pediocin is an antibacterial peptide which owns a strong potential on application for food and pharmaceutical industry. In this study, pediocin was introduced and expressed in E. coli by using pET43.a. The recombinant pediocin was successfully clevated from NusA-his-pediocin fusion protein and showed its strong antibacterial activity. The results in this study enable a new door for further study on pediocin production and application.

 

ACKNOWLEGDEMENT

We thank Vietnam National University, Ho Chi Minh City for funded this study.

 

CONTRIBUTION OF AUTHORS

Research concept- Dr. Dang Thi Phuong Thao, Nguyen Hieu Nghia

Research design- Dr. Dang Thi Phuong Thao, Nguyen Hieu Nghia

Supervision- Dr. Dang Thi Phuong Thao

Materials- Dr. Dang Thi Phuong Thao

Data collection-Nguyen Hieu Nghia, Nguyen Thi Cam Nhung

Data analysis and Interpretation- Dr. Dang Thi Phuong Thao, Nguyen Hieu Nghia

Literature search- Dr. Dang Thi Phuong Thao, Nguyen Hieu Nghia

Writing article- Dr. Dang Thi Phuong Thao, Nguyen Hieu Nghia

Critical review- Dr. Dang Thi Phuong Thao

Article editing- Dr. Dang Thi Phuong Thao, Nguyen Hieu Nghia

Final approval- Dr. Dang Thi Phuong Thao

 

REFERENCES

1.      Henderson JT, CHOPKO AL, wassenaar V, Dick P. Purification and primary structure of pediocin PA-1 produced by Pediococcus acidilactici PAC-1.0. Arch. Biochem. Biophys., 1992; 295(1): 5-12.

2.      Rodriguez JM, Martinez MI, Kok J, Pediocin PA-1, a wide-spectrum bacteriocin from lactic acid bacteria. Critical Rev. Food Sci. Nutr., 2002; 42(2): 91-121.

3.      Papagianni M, Anastasiadou S. Pediocins the bacteriocins of Pediococci. Sources, production, properties and applications. Microb. Cell Factories, 2009; 8(1): 1-16.

4.      Yousef AE, Luchansky JB, Degnan AJ, Doyle MP, Behavior of Listeria monocytogenes in wiener exudates in the presence of Pediococcus acidilactici H or pediocin AcH during storage at 4 or 25 degrees C. Appl. Environ. Microbiol., 1991; 57(5): 1461-67.

5.      Raccach M, Geshell D. The inhibition of Listeria monocytogenes in milk by pediococci. Food microbiol., 1993; 10(3): 181-86.

6.      MING X, WEBER GH, AYRES JW, SANDINE WE, Bacteriocins applied to food packaging materials to inhibit Listeria monocytogenes on meats. J. Food Sci., 1997; 62(2): 413-15.

7.      Rozum JJ, Maurer  AJ, Microbiological quality of cooked chicken breasts containing commercially available shelf-life extenders. Poultry Sci., 1997; 76(6): 908-13.

8.      Szabo E, Cahill M, Nisin ALTATM 2341 inhibit the growth of Listeria monocytogenes on smoked salmon packaged under vacuum or 100% CO2. Letters in Appl. Microbiol., 1999; 28(5): 373-77.

9.      Chen CM, Sebranek J, Dickson J, Mendonca A, Combining pediocin (ALTA 2341) with postpackaging thermal pasteurization for control of Listeria monocytogenes on frankfurters. J. Food Prot., 2004; 67(9): 1855-65.

10.  Montville T, Chen Y, Mechanistic action of pediocin and nisin: recent progress and unresolved questions. Applied microbiology and Biotechnol., 1998; 50(5): 511-19.

11.  Riley MA, Wertz JE. Bacteriocins: evolution, ecology, and application. Ann. Rev. Microbiol., 2002; 56(1): 117-37.

12.  Santiago-Silva P, Soares NF, Nobrega JE, Junior MA, Barbosa KB, et al. Antimicrobial efficiency of film incorporated with pediocin (ALTAฎ 2351) on preservation of sliced ham. Food Control, 2009; 20(1): 85-89.

13.  Nieto-Lozano JC, Reguera-Useros JI, Pelaez-Martinez MdC, Sacristan-Perez-Minayo, G, Gutierrez-Fernandez AJ, et al. The effect of the pediocin PA-1 produced by Pediococcus acidilactici against Listeria monocytogenes and Clostridium perfringens in Spanish dry-fermented sausages and frankfurters. Food Control, 2010; 21(5): 679-85.

14.  Halami PM, Chandrashekar A. Heterologous expression, purification and refolding of an anti-listerial peptide produced by Pediococcus acidilactici K7. Electronic J. Biotechnol., 2007; 10(4): 563-69.

15.  Moon G-S, Pyun Y-R., Kim WJ, Expression purification of a fusion-typed pediocin PA-1 in Escherichia coli and recovery of biologically active pediocin PA-1. Int. J. Food microbiol., 2006; 108(1): 136-40.

16.  Bhunia  AK, Johnson M, Ray B. Direct detection of an antimicrobial peptide of Pediococcus acidilactici in sodium dodecyl sulfate-polyacrylamide gel electrophoresis. J. Industrial Microbiol. Biotechnol., 1987; 2(5): 319-22.

17.  Fregeau G, Nancy L, et al. Three-dimensional structure of leucocin A in trifluoroethanol and dodecylphosphocholine micelles: spatial location of residues critical for biological activity in type IIa bacteriocins from lactic acid bacteria. Biochem., 1997, 36(49): 15062-72.

18.  Quadri, Luis EN, et al. Effect of amino acid substitutions on the activity of carnobacteriocin B2 overproduction of the antimicrobial peptide, its engineered variants, and its precursor in Escherichia coli. J. Biol. Chem., 1997; 272(6): 3384-88.

19.  Shin MS, et al. Isolation and partial characterization of a bacteriocin produced by Pediococcus pentosaceus K23-2 isolated from Kimchi. J. App. Microiol., 2008; 105(2): 331-39.

20.  Papagianni M,  Anastasiadou S. Pediocins: The bacteriocins of Pediococci. Sources, production, properties and applications. Microb. Cell Factories, 2009; 8(1): 3-9.